Arl13B Mouse Untagged Antibody

Lab Reagents

Human IgG antibody Laboratories manufactures the arl13b mouse untagged antibody reagents distributed by Genprice. The Arl13B Mouse Untagged Antibody reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact mouse Antibody. Other Arl13B products are available in stock. Specificity: Arl13B Category: Mouse Group: Untagged Antibody

Untagged Antibody information

Mouse ARL13B shRNA Plasmid
20-abx976507
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ARL13B Recombinant Protein (Mouse)
RP117092 100 ug Ask for price

ARL13B siRNA
20-abx908103
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARL13B siRNA
20-abx908104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARL13B Polyclonal Conjugated Antibody
C30641 100ul
EUR 397

Arl13b ORF Vector (Mouse) (pORF)
ORF039032 1.0 ug DNA
EUR 506

ARL13B Blocking Peptide
33R-8244 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARL13B antibody, catalog no. 70R-3969

ARL13B Blocking Peptide
33R-9507 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARL13B antibody, catalog no. 70R-4152

ARL13B Blocking Peptide
DF12000-BP 1mg
EUR 195

ARL13B cloning plasmid
CSB-CL659639HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: ATGTTCAGTCTGATGGCCAGTTGCTGCGGCTGGTTCAAGCGGTGGCGGGAGCCTGTCAGAAAGGTGACTCTTTTGATGGTGGGACTTGATAATGCTGGTAAAACCGCAACAGCAAAGGGAATCCAAGGAGAATACCCTGAAGATGTAGCTCCTACTGTTGGATTTTCAAAAATTA
  • Show more
Description: A cloning plasmid for the ARL13B gene.

ARL13B Rabbit pAb
A5200-100ul 100 ul
EUR 308

ARL13B Rabbit pAb
A5200-200ul 200 ul
EUR 459

ARL13B Rabbit pAb
A5200-20ul 20 ul
EUR 183

ARL13B Rabbit pAb
A5200-50ul 50 ul
EUR 223

Recombinant Human ARL13B
P0506 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q3SXY8
Description: Recombinant Human protein for ARL13B

Anti-ARL13B (7G9)
YF-MA20623 200 ul
EUR 363
Description: Mouse monoclonal to ARL13B

Polyclonal ARL13B antibody - middle region
APR15049G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARL13B - middle region. This antibody is tested and proven to work in the following applications: