Lab Reagents
Human IgG antibody Laboratories manufactures the arl13b mouse untagged antibody reagents distributed by Genprice. The Arl13B Mouse Untagged Antibody reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact mouse Antibody. Other Arl13B products are available in stock. Specificity: Arl13B Category: Mouse Group: Untagged Antibody
Untagged Antibody information
Mouse ARL13B shRNA Plasmid |
20-abx976507 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ARL13B Recombinant Protein (Mouse) |
RP117092 |
ABM |
100 ug |
Ask for price |
ARL13B siRNA |
20-abx908103 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARL13B siRNA |
20-abx908104 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARL13B Polyclonal Conjugated Antibody |
C30641 |
SAB |
100ul |
EUR 397 |
Arl13b ORF Vector (Mouse) (pORF) |
ORF039032 |
ABM |
1.0 ug DNA |
EUR 506 |
ARL13B Rabbit pAb |
A5200-100ul |
Abclonal |
100 ul |
EUR 308 |
ARL13B Rabbit pAb |
A5200-200ul |
Abclonal |
200 ul |
EUR 459 |
ARL13B Rabbit pAb |
A5200-20ul |
Abclonal |
20 ul |
EUR 183 |
ARL13B Rabbit pAb |
A5200-50ul |
Abclonal |
50 ul |
EUR 223 |
ARL13B Blocking Peptide |
33R-8244 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARL13B antibody, catalog no. 70R-3969 |
ARL13B Blocking Peptide |
33R-9507 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARL13B antibody, catalog no. 70R-4152 |
ARL13B Blocking Peptide |
DF12000-BP |
Affbiotech |
1mg |
EUR 195 |
ARL13B cloning plasmid |
CSB-CL659639HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1287
- Sequence: ATGTTCAGTCTGATGGCCAGTTGCTGCGGCTGGTTCAAGCGGTGGCGGGAGCCTGTCAGAAAGGTGACTCTTTTGATGGTGGGACTTGATAATGCTGGTAAAACCGCAACAGCAAAGGGAATCCAAGGAGAATACCCTGAAGATGTAGCTCCTACTGTTGGATTTTCAAAAATTA
- Show more
|
Description: A cloning plasmid for the ARL13B gene. |
Recombinant Human ARL13B |
P0506 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: Q3SXY8
|
Description: Recombinant Human protein for ARL13B |
Anti-ARL13B (7G9) |
YF-MA20623 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to ARL13B |
Polyclonal ARL13B antibody - middle region |
APR15049G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARL13B - middle region. This antibody is tested and proven to work in the following applications: |