Nucleic Acid Databases and Molecular-Scale Computing.

DNA outperforms most standard storage media when it comes to info retention time, bodily density, and volumetric coding capability. Advances in synthesis and sequencing applied sciences have enabled implementations of enormous artificial DNA databases with spectacular storage capability and dependable information restoration. Several strong DNA storage architectures that includes random entry, error correction, and content material rewritability have been constructed with the potential for scalability and value discount.

We survey these current achievements and talk about different routes for overcoming the hurdles of engineering sensible DNA storage methods. We additionally evaluation current thrilling work on in vivo DNA reminiscence together with intracellular recorders constructed by programmable genome modifying instruments. Besides info storage, DNA might function a flexible molecular computing substrate.

We spotlight a number of state-of-the-art DNA computing methods comparable to strand displacement, localized hybridization chain reactions, and enzymatic response networks. We summarize how these easy primitives have facilitated rational designs and implementations of in vitro DNA response networks that emulate digital/analog circuits, synthetic neural networks, or nonlinear dynamic methods. We envision these modular primitives might be strategically tailored for classy database operations and massively parallel computations on DNA databases.

We additionally spotlight in vivo DNA computing modules comparable to CRISPR logic gates for constructing scalable genetic circuits in dwelling cells. To conclude, we talk about numerous implications and challenges of DNA-based storage and computing, and we notably encourage progressive work on bridging these two areas of analysis to additional discover molecular parallelism and near-data processing. Such built-in molecular methods might result in far-reaching functions in biocomputing, safety, and drugs.

 Nucleic Acid Databases and Molecular-Scale Computing.
Nucleic Acid Databases and Molecular-Scale Computing.

Pathways to mobile supremacy in biocomputing.

Synthetic biology makes use of dwelling cells because the substrate for performing human-defined computations. Many present implementations of mobile computing are primarily based on the “genetic circuit” metaphor, an approximation of the operation of silicon-based computer systems. Although this conceptual mapping has been comparatively profitable, we argue that it basically limits the forms of computation that could be engineered contained in the cell, and fails to take advantage of the wealthy and various performance out there in pure dwelling methods.

We suggest the notion of “mobile supremacy” to focus consideration on domains by which biocomputing may supply superior efficiency over conventional computer systems. We think about potential pathways towards mobile supremacy, and counsel utility areas by which it might be discovered.

Synthetic biology goals to rewire mobile actions and performance by implementing genetic circuits with excessive biocomputing capabilities. Recent efforts led to the event of sensible sensing interfaces which combine a number of inputs to activate desired outputs in a extremely particular and delicate method. In this evaluation, we spotlight protein-based interfaces that sense intracellular or extracellular cues offering details about dynamic environmental adjustments and mobile state.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DLR-TPH2-Hu-96T 96T
EUR 673.00
  • Should the Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tryptophan Hydroxylase 2 (TPH2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DLR-TPH2-Mu-48T 48T
EUR 527.00
  • Should the Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DLR-TPH2-Mu-96T 96T
EUR 688.00
  • Should the Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DLR-TPH2-Ra-48T 48T
EUR 549.00
  • Should the Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DLR-TPH2-Ra-96T 96T
EUR 718.00
  • Should the Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tryptophan Hydroxylase 2 (TPH2)

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tryptophan Hydroxylase 2 (TPH2)

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tryptophan Hydroxylase 2 (TPH2)

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Mu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tryptophan Hydroxylase 2 (TPH2)

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Mu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tryptophan Hydroxylase 2 (TPH2)

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Mu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tryptophan Hydroxylase 2 (TPH2)

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Ra-192 1 kit of 192 tests
EUR 1237.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Tryptophan Hydroxylase 2 (TPH2)

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Ra-48 1 kit of 48 tests
EUR 512.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Tryptophan Hydroxylase 2 (TPH2)

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DL-TPH2-Ra-96 1 kit of 96 tests
EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Tryptophan Hydroxylase 2 (TPH2)

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Hu-48Tests 48 Tests
EUR 521.00

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Hu-96Tests 96 Tests
EUR 723.00

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Mu-48Tests 48 Tests
EUR 533.00

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Mu-96Tests 96 Tests
EUR 740.00

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Ra-48Tests 48 Tests
EUR 557.00

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Ra-96Tests 96 Tests
EUR 775.00

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Hu-48Tests 48 Tests
EUR 544.00

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Hu-96Tests 96 Tests
EUR 756.00

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Mu-48Tests 48 Tests
EUR 557.00

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Mu-96Tests 96 Tests
EUR 774.00

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Ra-48Tests 48 Tests
EUR 583.00

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Ra-96Tests 96 Tests
EUR 811.00

TPH2 Antibody

1-CSB-PA006960
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

TPH2 Antibody

1-CSB-PA161937
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

TPH2 Antibody

1-CSB-PA809000LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TPH2 Antibody

43424-100ul 100ul
EUR 252.00

TPH2 antibody

70R-34658 100 ug
EUR 327.00
Description: Purified Rabbit polyclonal TPH2 antibody

TPH2 antibody

70R-2005 50 ug
EUR 467.00
Description: Rabbit polyclonal TPH2 antibody raised against the middle region of TPH2

TPH2 antibody

70R-2011 50 ug
EUR 467.00
Description: Rabbit polyclonal TPH2 antibody raised against the N terminal of TPH2

TPH2 Antibody

1-CSB-PA917997
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50

TPH2 Antibody

DF8732 200ul
EUR 304.00
Description: TPH2 Antibody detects endogenous levels of total TPH2.

TPH2 Antibody

ABD8732 100 ug
EUR 438.00

TPH2 Conjugated Antibody

C43424 100ul
EUR 397.00

TPH2 antibody (Ser19)

70R-34657 100 ug
EUR 327.00
Description: Purified Rabbit polyclonal TPH2 antibody (Ser19)

TPH2 antibody (Ser58)

70R-35594 100 ug
EUR 327.00
Description: Rabbit polyclonal TPH2 antibody (Ser58)

TPH2 Polyclonal Antibody

ABP53691-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

TPH2 Polyclonal Antibody

ABP53691-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

TPH2 Polyclonal Antibody

ABP53691-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

TPH2 (pS19) Antibody

abx333346-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

TPH2 antibody (Ser19)

70R-15074 100 ul
EUR 392.00
Description: Rabbit polyclonal TPH2 antibody (Ser19)

TPH2 Polyclonal Antibody

E-AB-33132-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The enc
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey TPH2 for WB,ELISA applications.

TPH2 Polyclonal Antibody

E-AB-33132-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The enc
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey TPH2 for WB,ELISA applications.

TPH2 Polyclonal Antibody

E-AB-33132-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The enc
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey TPH2 for WB,ELISA applications.

TPH2 Polyclonal Antibody

ES4690-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPH2 Polyclonal Antibody

ES4690-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- TPH2 antibody

FNab08885 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: tryptophan hydroxylase 2
  • Uniprot ID: Q8IWU9
  • Gene ID: 121278
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against TPH2

Anti-TPH2 antibody

PAab08885 100 ug
EUR 355.00

Anti-TPH2 antibody

STJ116731 100 µl
EUR 277.00
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.

Anti-TPH2 antibody

STJ96076 200 µl
EUR 197.00
Description: Rabbit polyclonal to TPH2.

Anti-TPH2 antibody

STJ29227 100 µl
EUR 277.00
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.

Tph2/ Rat Tph2 ELISA Kit

ELI-07130r 96 Tests
EUR 886.00

TPH2 siRNA

20-abx905746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPH2 siRNA

20-abx937835
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPH2 siRNA

20-abx937836
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-TPH2 (S19) Antibody

1-CSB-PA006958
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TPH2 (S19). Recognizes Phospho-TPH2 (S19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

Phospho-TPH2 (Ser19) Antibody

CSB-PA123981-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-TPH2 (Ser19) Antibody

CSB-PA123981-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TPH2 Antibody, HRP conjugated

1-CSB-PA809000LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TPH2 Antibody, FITC conjugated

1-CSB-PA809000LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TPH2 Antibody, Biotin conjugated

1-CSB-PA809000LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TPH2 (Ab-19) Antibody

CSB-PA272667-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TPH2 (Ab-19) Antibody

CSB-PA272667-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TPH2 (Phospho-Ser19) Antibody

11828-100ul 100ul
EUR 252.00

TPH2 (Phospho-Ser19) Antibody

11828-50ul 50ul
EUR 187.00

TPH2 (Ab-19) Antibody

33305-100ul 100ul
EUR 252.00

TPH2 (Ab-19) Antibody

33305-50ul 50ul
EUR 187.00

Anti-Tph2 (mouse) antibody

STJ72618 100 µg
EUR 359.00

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx129888
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TPH2 (Ab-19) Conjugated Antibody

C33305 100ul
EUR 397.00

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx013001
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx034260
  • EUR 342.00
  • EUR 523.00
  • 100 ul
  • 400 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx034260-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

TPH2 (phospho Ser19) Polyclonal Antibody

ABP53690-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody

ABP53690-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody

ABP53690-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx005394
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx145380-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx329873
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx331689-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx178740
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx178741
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx178742
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx213686
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx213944
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx430991-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (Tph2) Antibody

abx431655-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx431656-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx238885-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx302298
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx174958
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx174959
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

TPH2 (phospho Ser19) Polyclonal Antibody

ES4689-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPH2 (phospho Ser19) Polyclonal Antibody

ES4689-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-TPH2 (aa16-29) antibody

STJ72617 100 µg
EUR 359.00

Anti-Phospho-TPH2 (S19) antibody

STJ90661 200 µl
EUR 197.00
Description: Rabbit polyclonal to Phospho-TPH2 (S19).

TPH2 cloning plasmid

CSB-CL809000HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: ATGCAGCCAGCAATGATGATGTTTTCCAGTAAATACTGGGCACGGAGAGGGTTTTCCCTGGATTCAGCAGTGCCCGAAGAGCATCAGCTACTTGGCAGCTCAACAGCTTCGACATTCCTGAAGCTAAATAAACCTAACTCTGGCAAAAATGACGACAAAGGCAACAAGGGAAGCA
  • Show more
Description: A cloning plasmid for the TPH2 gene.

TPH2 Blocking Peptide

33R-4561 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2005

TPH2 Blocking Peptide

33R-7865 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2011

TPH2 Blocking Peptide

DF8732-BP 1mg
EUR 195.00

TPH2 Rabbit pAb

A14520-200ul 200 ul
EUR 459.00

TPH2 Rabbit pAb

A14520-50ul 50 ul
EUR 223.00

TPH2 Rabbit pAb

A14520-100ul 100 ul
EUR 308.00

TPH2 Rabbit pAb

A14520-20ul 20 ul
EUR 183.00

TPH2 Rabbit pAb

A7147-100ul 100 ul
EUR 308.00

TPH2 Rabbit pAb

A7147-200ul 200 ul
EUR 459.00

TPH2 Rabbit pAb

A7147-20ul 20 ul
EUR 183.00

TPH2 Rabbit pAb

A7147-50ul 50 ul
EUR 223.00

TPH2 (Phospho-Ser19) Polyclonal Conjugated Antibody

C11828 100ul
EUR 397.00

Tryptophan Hydroxylase 2 (TPH2) Antibody (HRP)

20-abx316362
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody (FITC)

20-abx316363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody (Biotin)

20-abx316364
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Tryptophan hydroxylase 2 / TPH2 antibody

STJ70833 100 µg
EUR 359.00

Mouse TPH2 shRNA Plasmid

20-abx980994
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TPH2 shRNA Plasmid

20-abx989991
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TPH2 shRNA Plasmid

20-abx964667
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TPH2 ELISA Kit

ELA-E2229h 96 Tests
EUR 824.00

TPH2 ELISA KIT|Human

EF006246 96 Tests
EUR 689.00

TPH2 Recombinant Protein (Human)

RP044410 100 ug Ask for price

TPH2 Recombinant Protein (Mouse)

RP180680 100 ug Ask for price

TPH2 Recombinant Protein (Rat)

RP234368 100 ug Ask for price

Polyclonal TPH2 (aa16-29) Antibody (N-Term)

APR13778G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPH2 (aa16-29) (N-Term). This antibody is tested and proven to work in the following applications:

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse)

4-PAG343Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2)

TPH2 ORF Vector (Human) (pORF)

ORF014804 1.0 ug DNA
EUR 354.00

Tph2 ORF Vector (Mouse) (pORF)

ORF060228 1.0 ug DNA
EUR 506.00

Tph2 ORF Vector (Rat) (pORF)

ORF078124 1.0 ug DNA
EUR 506.00

pECMV-Tph2-m-FLAG Plasmid

PVT14992 2 ug
EUR 325.00

Recombinant Tryptophan Hydroxylase 2 (TPH2)

4-RPG343Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CGV2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tryptophan Hydroxylase 2 expressed in: E.coli

Polyclonal Tryptophan hydroxylase 2 / TPH2 Antibody (internal region)

APR13831G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Tryptophan hydroxylase 2 / TPH2 (internal region). This antibody is tested and proven to work in the following applications:

Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody

20-abx012729
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody

20-abx327772
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC

4-PAG343Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Biotinylated

4-PAG343Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Biotin.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Cy3

4-PAG343Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Cy3.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), FITC

4-PAG343Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with FITC.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), HRP

4-PAG343Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with HRP.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), PE

4-PAG343Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with PE.

Mouse Tryptophan Hydroxylase 2 (TPH2) Protein

20-abx168392
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Tryptophan 5-hydroxylase 2 (TPH2)

1-CSB-CF809000HU
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 60.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tryptophan 5-hydroxylase 2(TPH2) expressed in in vitro E.coli expression system

Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

abx595600-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

Human Tryptophan Hydroxylase 2 (TPH2) Protein

20-abx655364
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Tryptophan Hydroxylase 2 (TPH2) Protein

20-abx655365
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

TPH2 Colorimetric Cell-Based ELISA Kit

EKC1573 100ul
EUR 572.00

TPH2 sgRNA CRISPR Lentivector set (Human)

K2428101 3 x 1.0 ug
EUR 339.00

Tph2 sgRNA CRISPR Lentivector set (Mouse)

K4118401 3 x 1.0 ug
EUR 339.00

Tph2 sgRNA CRISPR Lentivector set (Rat)

K7297901 3 x 1.0 ug
EUR 339.00

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAG343Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC-Cy7.

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

20-abx154794
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

20-abx156179
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

20-abx153361
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tryptophan Hydroxylase 2 (TPH2) CLIA Kit

20-abx495166
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Tryptophan Hydroxylase 2 (TPH2) CLIA Kit

20-abx495167
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Tryptophan Hydroxylase 2 (TPH2) CLIA Kit

20-abx495168
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

TPH2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2428102 1.0 ug DNA
EUR 154.00

TPH2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2428103 1.0 ug DNA
EUR 154.00

TPH2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2428104 1.0 ug DNA
EUR 154.00

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4118402 1.0 ug DNA
EUR 154.00

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4118403 1.0 ug DNA
EUR 154.00

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4118404 1.0 ug DNA
EUR 154.00

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7297902 1.0 ug DNA
EUR 154.00

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7297903 1.0 ug DNA
EUR 154.00

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7297904 1.0 ug DNA
EUR 154.00

TPH2 Protein Vector (Rat) (pPB-C-His)

PV312494 500 ng
EUR 603.00

TPH2 Protein Vector (Rat) (pPB-N-His)

PV312495 500 ng
EUR 603.00

TPH2 Protein Vector (Rat) (pPM-C-HA)

PV312496 500 ng
EUR 603.00

TPH2 Protein Vector (Rat) (pPM-C-His)

PV312497 500 ng
EUR 603.00

TPH2 Protein Vector (Mouse) (pPB-C-His)

PV240910 500 ng
EUR 603.00

TPH2 Protein Vector (Mouse) (pPB-N-His)

PV240911 500 ng
EUR 603.00

We may even talk about totally different mechanisms of regulation of gene expression linked to the sensors to develop diagnostic and therapeutic units. We conclude discussing challenges and alternatives for biomedical functions of artificial mammalian protein-based units.